BMRB Entry 30665
Click here to enlarge.
PDB ID: 6u79
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30665
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sharma, S.; Varani, G.. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication" Biochem. Biophys. Res. Commun. 531, 522-527 (2020).
PubMed: 32807496
Assembly members:
entity_1, polymer, 37 residues, 11841.064 Da.
Natural source: Common Name: West Nile virus Taxonomy ID: 11082 Superkingdom: Viruses Kingdom: not available Genus/species: Flavivirus West Nile virus
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUUUCUUAGCACGAAGAUC
UCGAUGUCUAAGAAACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 215 |
| 15N chemical shifts | 13 |
| 1H chemical shifts | 277 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 37 residues - 11841.064 Da.
| 1 | G | G | U | U | U | C | U | U | A | G | ||||
| 2 | C | A | C | G | A | A | G | A | U | C | ||||
| 3 | U | C | G | A | U | G | U | C | U | A | ||||
| 4 | A | G | A | A | A | C | C |