Click here to enlarge.
PDB ID: 6vzc
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30730
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Chang, A.; Chen, L.; Song, L.; Zhang, S.; Nikonowicz, E.. "2-Amino-1,3-benzothiazole-6-carboxamide Preferentially Binds the Tandem Mismatch Motif r(UY:GA)" Biochemistry 59, 3225-3234 (2020).
PubMed: 32786414
Assembly members:
entity_1, polymer, 28 residues, 8963.334 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGCUGUGAUGCUUCGGCAU
AUCAGCCC
Data type | Count |
13C chemical shifts | 215 |
15N chemical shifts | 51 |
1H chemical shifts | 239 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 28 residues - 8963.334 Da.
1 | G | G | G | C | U | G | U | G | A | U | ||||
2 | G | C | U | U | C | G | G | C | A | U | ||||
3 | A | U | C | A | G | C | C | C |