Click here to enlarge.
PDB ID: 6ffr
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34228
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Haase, L.; Dickerhoff, J.; Weisz, K.. "DNA-RNA Hybrid Quadruplexes Reveal Interactions that Favor RNA Parallel Topologies" Chemistry 24, 15365-15371 (2018).
PubMed: 30084512
Assembly members:
entity_1, polymer, 22 residues, 7004.491 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGATGGGACACAGGGGACG
GG
Data type | Count |
13C chemical shifts | 21 |
1H chemical shifts | 142 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 22 residues - 7004.491 Da.
1 | G | DG | DG | DA | DT | DG | DG | DG | DA | DC | ||||
2 | DA | DC | DA | DG | DG | DG | DG | DA | DC | G | ||||
3 | DG | DG |