Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50352
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wacker, Anna; Weigand, Julia; Akabayov, Sabine; Altincekic, Nadide; Kaur Bains, Jasleen; Banijamali, Elnaz; Binas, Oliver; Castillo-Martinez, Jesus; Cetiner, Erhan; Ceylan, Betul; Chiu, Liang-Yuan; Davila-Calderon, Jesse; De Jesus, Vanessa; Dhamotharan, Karthikeyan; Duchardt-Ferner, Elke; Ferner, Jan; Frydman, Lucio; Furtig, Boris; Gallego, Jose; Grun, J. Tassilo; Hacker, Carolin; Haddad, Christina; Hahnke, Martin; Hengesbach, Martin; Hiller, Fabian; Hohmann, Katharina; Hymon, Daniel; Jonker, Henry; Keller, Heiko; Knezic, Bozana; Landgraf, Tom; Lohr, Frank; Luo, Luke; Mertinkus, Klara; Muhs, Christina; Novakovic, Mihajlo; Oxenfarth, Andreas; Palomino-Schatzlein, Martina; Petzold, Katja; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Riad, Magdalena; Richter, Christian; Saxena, Krishna; Schamber, Tatjana; Scherf, Tali; Schlagnitweit, Judith; Schlundt, Andreas; Schnieders, Robbin; Schwalbe, Harald; Simba-Lahuasi, Alvaro; Sreeramulu, Sridhar; Stirnal, Elke; Sudakov, Alexey; Tants, Jan-Niklas; Tolbert, Blanton; Vogele, Jenny; Weiss, Lena; Wirmer-Bartoschek, Julia; Wirtz Martin, Maria; Wohnert, Jens; Zetzsche, Heidi. "Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy" Nucleic Acids Res. 48, 12415-12435 (2020).
PubMed: 33167030
Assembly members:
entity_1, polymer, 63 residues, Formula weight is not available
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: reverse transcriptase
Entity Sequences (FASTA):
entity_1: GGACUUGUGGCUUAGUAGAA
GUUGAAAAAGGCGUUUUGCC
UCAACUUGAACAGCCCUAUG
UCC
Data type | Count |
15N chemical shifts | 34 |
1H chemical shifts | 28 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | 5_SL8 | 1 |
Entity 1, 5_SL8 63 residues - Formula weight is not available
1 | G | G | A | C | U | U | G | U | G | G | ||||
2 | C | U | U | A | G | U | A | G | A | A | ||||
3 | G | U | U | G | A | A | A | A | A | G | ||||
4 | G | C | G | U | U | U | U | G | C | C | ||||
5 | U | C | A | A | C | U | U | G | A | A | ||||
6 | C | A | G | C | C | C | U | A | U | G | ||||
7 | U | C | C |