BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 52355

Title: 8-17 DNAzyme in presence of various metal ions

Deposition date: 2024-03-15 Original release date: 2024-03-18

Authors: Andralojc, Witold

Citation: Andralojc, Witold. "The 8-17 DNAzyme can operate in a single active structure regardless of the metal ion cofactor"  .

Assembly members:
entity_1, polymer, 35 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: CGCCGGGGTCGAAGACTGCC AGCGGCTCGACGGCG

Data typeCount
1H chemical shifts2071
31P chemical shifts180

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
18-17 DNAzyme1

Entities:

Entity 1, 8-17 DNAzyme 35 residues - Formula weight is not available

1   DCDGDCDCDGDGDGDGDTDC
2   DGDADADGDADCDTDGDCDC
3   DADGDCDGDGDCDTDCDGDA
4   DCDGDGDCDG

Samples:

sample_1: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; NaCl 400 mM

sample_2: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; ZnCl2 1.5 mM

sample_3: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; MgCl2 7.5 mM

sample_4: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; MgCl2 3.5 mM

sample_5: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; NaCl 400 mM; ZnCl2 1.5 mM

sample_6: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; NaCl 400 mM; ZnCl2 3.0 mM

sample_7: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; NaCl 400 mM; ZnCl2 4.5 mM

sample_8: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; ZnCl2 3.0 mM

sample_9: 8-17 DNAzyme 1.5 mM; sodium cacodylate 10 mM; ZnCl2 4.5 mM

sample_conditions_1: ionic strength: 0.4 M; pH: 6.0; pressure: 1 atm; temperature: 293 K

sample_conditions_2: ionic strength: 0.01 M; pH: 6.0; pressure: 1 atm; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_3isotropicsample_conditions_2
2D 1H-1H NOESYsample_4isotropicsample_conditions_2
2D 1H-1H NOESYsample_5isotropicsample_conditions_1
2D 1H-1H NOESYsample_6isotropicsample_conditions_1
2D 1H-1H NOESYsample_7isotropicsample_conditions_1
2D 1H-1H NOESYsample_8isotropicsample_conditions_2
2D 1H-1H NOESYsample_9isotropicsample_conditions_2

Software:

NMRFAM-SPARKY - chemical shift assignment

NMR spectrometers:

  • Bruker AVANCE III 700 MHz