BMRB Entry 6543
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6543
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: HIV-1 frameshift inducing element RNA PubMed: 15927637
Deposition date: 2005-03-10 Original release date: 2006-11-06
Authors: Staple, David; Butcher, Samuel
Citation: Staple, David; Butcher, Samuel. "Soultion structure and thermodynamic investigation of the HIV-1 frameshift inducing element" J. Mol. Biol. 349, 1011-1023 (2005).
Assembly members:
HIV-1 frameshift induciting element RNA, polymer, 45 residues, Formula weight is not available
Natural source: Common Name: HIV Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: Not applicable Genus/species: HIV HIV
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
HIV-1 frameshift induciting element RNA: GGGAAGAUCUGGCCUUCCCA
CAAGGGAAGGCCAGGGAAUC
UUCCC
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 308 |
13C chemical shifts | 91 |
15N chemical shifts | 24 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | HIV-1 frameshift inducing RNA | 1 |
Entities:
Entity 1, HIV-1 frameshift inducing RNA 45 residues - Formula weight is not available
1 | G | G | G | A | A | G | A | U | C | U | ||||
2 | G | G | C | C | U | U | C | C | C | A | ||||
3 | C | A | A | G | G | G | A | A | G | G | ||||
4 | C | C | A | G | G | G | A | A | U | C | ||||
5 | U | U | C | C | C |
Samples:
sample_1: HIV-1 frameshift induciting element RNA, [U-13C; U-15N]-A,U, 1 mM; NaCl 50 mM; D2O 10%; H2O 90%
sample_2: HIV-1 frameshift induciting element RNA, [U-13C; U-15N]-G,C, 1 mM; NaCl 50 mM; D2O 100%
conditions_1: pH: 6.8; pressure: 1 atm; temperature: 303 K
conditions_2: pH: 6.8; pressure: 1 atm; temperature: 283 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | not available | not available | not available |
2D 1H-1H TOCSY | not available | not available | not available |
2D 1H-13C HSQC | not available | not available | not available |
2D 1H-15N HMQC | not available | not available | not available |
2D HNN COSY | not available | not available | not available |
3D HCCH TOCSY | not available | not available | not available |
3D HCCH COSY | not available | not available | not available |
3D NOESY-HMQC | not available | not available | not available |
Filter/Edit 2D 1H-1H NOEY | not available | not available | not available |
Software:
No software information available
NMR spectrometers:
- Bruker DMX 600 MHz
- Bruker DMX 750 MHz
- Varian Inova 800 MHz
- Varian Inova 900 MHz