Click here to enlarge.
PDB ID: 2qh3
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR7404
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Theimer, C.; Jady, B.; Chim, N.; Richard, P.; Breece, K.; Kiss, T.; Feigon, J.. "Structural and functional characterization of human telomerase RNA processing and cajal body localization signals" Mol. Cell 27, 869-881 (2007).
PubMed: 17889661
Assembly members:
Human_U64_H-ACA_snoRNA, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Human_U64_H-ACA_snoRNA: GGAGUGCCUUACUGUGGCAC
UCC
Data type | Count |
13C chemical shifts | 127 |
15N chemical shifts | 31 |
1H chemical shifts | 188 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | Human U64 H/ACA snoRNA | 1 |
Entity 1, Human U64 H/ACA snoRNA 23 residues - Formula weight is not available
1 | G | G | A | G | U | G | C | C | U | U | ||||
2 | A | C | U | G | U | G | G | C | A | C | ||||
3 | U | C | C |