Click here to enlarge.
PDB ID: 2fdt
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR10018
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Nomura, Yusuke; Kajikawa, Masaki; Baba, Seiki; Nakazato, Shinta; Imai, T.; Sakamoto, Taiichi; Okada, Norihiro; Kawai, Gota. "Solution structure and functional importance of a conserved RNA hairpin of eel LINE UnaL2" Nucleic Acids Res. 34, 5184-5193 (2006).
PubMed: 17000640
Assembly members:
LINE36, polymer, 36 residues, Formula weight is not available
Natural source: Common Name: Japanese eel Taxonomy ID: 7937 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Anguilla Japonica
Experimental source: Production method: enzymatic synthesis
Entity Sequences (FASTA):
LINE36: GGUUGUACGUCGCUUUGGAU
AAAAGCGUCUGCGACC
Data type | Count |
1H chemical shifts | 178 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA hairpin of eel LINE | 1 |
Entity 1, RNA hairpin of eel LINE 36 residues - Formula weight is not available
1 | G | G | U | U | G | U | A | C | G | U | ||||
2 | C | G | C | U | U | U | G | G | A | U | ||||
3 | A | A | A | A | G | C | G | U | C | U | ||||
4 | G | C | G | A | C | C |