Click here to enlarge.
PDB ID: 2o32
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15080
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sashital, Dipali; Venditti, Vincenzo; Angers, Cortney; Cornilescu, Gabriel; Butcher, Samuel. "Structure and thermodynamics of a conserved U2 snRNA domain from
yeast and human" RNA 13, 328-338 (2007).
PubMed: 17242306
Assembly members:
Yeast_U2_Stem_I, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Yeast_U2_Stem_I: GGUUUGCCUUUUGGCUUACC
Data type | Count |
13C chemical shifts | 133 |
1H chemical shifts | 177 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | Yeast U2 stem I | 1 |
Entity 1, Yeast U2 stem I 20 residues - Formula weight is not available
1 | G | G | U | U | U | G | C | C | U | U | |
2 | U | U | G | G | C | U | U | A | C | C |