BMRB Entry DOI: doi:10.13018/BMR15786
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Van der Werf, Ramon; Girard, Frederic; Nelissen, Frank; Tessari, Marco; Wijmenga, Sybren. "1H, 13C and 15N NMR assignments of Duck HBV primer loop of the encapsidation signal epsilon" Biomol. NMR Assignments 2, 143-145 (2008).
PubMed: 19636890
Assembly members:
EDHBVwt, polymer, 37 residues, Formula weight is not available
Natural source: Common Name: Hepatitis B Virus Taxonomy ID: 10407 Superkingdom: Viruses Kingdom: not available Genus/species: Orthohepadnavirus Hepatitis B Virus
Experimental source: Production method: enzymatic semisynthesis Host organism: Escherichia coli
Entity Sequences (FASTA):
EDHBVwt: GGACGAUCUUUACGUCCGCU
UCGGCGGACUGUCGUCC
Data type | Count |
13C chemical shifts | 187 |
15N chemical shifts | 50 |
1H chemical shifts | 285 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | primer_loop | 1 |
Entity 1, primer_loop 37 residues - Formula weight is not available
1 | G | G | A | C | G | A | U | C | U | U | ||||
2 | U | A | C | G | U | C | C | G | C | U | ||||
3 | U | C | G | G | C | G | G | A | C | U | ||||
4 | G | U | C | G | U | C | C |