Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15857
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kruschel, Daniela; Sigel, Roland. "Solution structure of the 5'-splice site of a group II intron ribozyme" .
Assembly members:
RNA_(29-MER), polymer, 29 residues, Formula weight is not available
RNA_(7-MER), polymer, 7 residues, Formula weight is not available
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: in vitro transcription Host organism: Saccharomyces cerevisiae
Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA
GCAUACUCC
RNA_(7-MER): CAGUGUC
Data type | Count |
13C chemical shifts | 77 |
15N chemical shifts | 13 |
1H chemical shifts | 306 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (29-MER) | 1 |
2 | RNA (7-MER) | 2 |
Entity 1, RNA (29-MER) 29 residues - Formula weight is not available
1 | G | G | A | G | U | A | U | G | U | A | ||||
2 | U | U | G | G | C | A | C | U | G | A | ||||
3 | G | C | A | U | A | C | U | C | C |
Entity 2, RNA (7-MER) 7 residues - Formula weight is not available
1 | C | A | G | U | G | U | C |