Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16604
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Schmidtke, Sina; Duchardt-Ferner, Elke; Weigand, Julia; Suess, Beatrix; Woehnert, Jens. "NMR resonance assignments of an engineered neomycin-sensing riboswitch RNA bound to ribostamycin and tobramycin" Biomol. NMR Assign. 4, 115-118 (2010).
PubMed: 20306311
Assembly members:
Neo-Riboswitch, polymer, 27 residues, 467.514 Da.
TOY, non-polymer, 467.514 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: in vitro transcription Host organism: Saccharomyces cerevisiae
Entity Sequences (FASTA):
Neo-Riboswitch: GGCUGCUUGUCCUUUAAUGG
UCCAGUC
Data type | Count |
13C chemical shifts | 174 |
15N chemical shifts | 49 |
1H chemical shifts | 235 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA | 1 |
2 | Aminoglycoside | 2 |
Entity 1, RNA 27 residues - 467.514 Da.
1 | G | G | C | U | G | C | U | U | G | U | ||||
2 | C | C | U | U | U | A | A | U | G | G | ||||
3 | U | C | C | A | G | U | C |
Entity 2, Aminoglycoside - C18 H37 N5 O9 - 467.514 Da.
1 | TOY |