BMRB Entry 16609
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16609
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with ribostamycin PubMed: 20306311
Deposition date: 2009-11-16 Original release date: 2010-09-02
Authors: Duchardt-Ferner, Elke; Schmidtke, Sina; Weigand, Julia; Suess, Beatrix; Woehnert, Jens
Citation: Schmidtke, Sina; Duchardt-Ferner, Elke; Weigand, Julia; Suess, Beatrix; Wohnert, Jens. "NMR resonance assignments of an engineered neomycin-sensing riboswitch RNA bound to ribostamycin and tobramycin" Biomol. NMR Assign. 4, 115-118 (2010).
Assembly members:
Neo-Aptamer, polymer, 27 residues, Formula weight is not available
RIO, non-polymer, 454.473 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: in vitro transcription Host organism: Saccharomyces cerevisiae
Entity Sequences (FASTA):
Neo-Aptamer: GGCUGCUUGUCCUUUAAUGG
UCCAGUC
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 248 |
15N chemical shifts | 53 |
13C chemical shifts | 180 |
31P chemical shifts | 9 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA | 1 |
2 | Aminoglycoside | 2 |
Entities:
Entity 1, RNA 27 residues - Formula weight is not available
1 | G | G | C | U | G | C | U | U | G | U | ||||
2 | C | C | U | U | U | A | A | U | G | G | ||||
3 | U | C | C | A | G | U | C |
Entity 2, Aminoglycoside - C17 H34 N4 O10 - 454.473 Da.
1 | RIO |
Samples:
sample_1: Neo-Aptamer 1.0 mM; Ribostamycin 1.1 mM; potassium cloride 50 mM; potassium phosphate 25 mM; H2O 90%; D20 10%
sample_2: Neo-Aptamer, [U-15N], 1.3 mM; Ribostamycin 1.4 mM; potassium cloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%
sample_3: Neo-Aptamer, [U-13C; U-15N], 1.4 mM; Ribostamycin 1.5 mM; potassium cloride 50 mM; potassium phosphate 25 mM; H2O 90%; D2O 10%
sample_4: Neo-Aptamer, [U-13C; U-15N], 1.4 mM; Ribostamycin 1.5 mM; potassium cloride 50 mM; potassium phosphate 25 mM; D2O 100%
sample_5: Neo-Aptamer, [U-13C; U-15N; U-2H], 1.2 mM; Ribostamycin 1.3 mM; potassium cloride 50 mM; potassium phosphate 25 mM; D2O 100%
condition_1: pH: 6.2; pressure: 1 atm; temperature: 283 K
condition_2: pH: 6.2; pressure: 1 atm; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
1D 1H-HS11ECHO | sample_1 | isotropic | condition_1 |
2D 1H-1H NOESY | sample_1 | isotropic | condition_1 |
2D 1H-15N HSQC | sample_2 | isotropic | condition_1 |
2D 1H-15N-HNN-COSY | sample_3 | isotropic | condition_1 |
2D 1H-13C-HNCO | sample_3 | isotropic | condition_1 |
2D 1H-13C H5(6)C5(6)C4N3H | sample_3 | isotropic | condition_1 |
2D 1H-15N HCN | sample_4 | isotropic | condition_2 |
3D 1H-15N NOESY-HSQC | sample_2 | isotropic | condition_1 |
2D 1H-13C HSQC | sample_3 | isotropic | condition_1 |
2D 1H-13C HSQC | sample_4 | isotropic | condition_2 |
3D HCCH-COSY | sample_4 | isotropic | condition_2 |
3D HCCH-TOCSY | sample_4 | isotropic | condition_2 |
3D 1H-13C NOESY-HSQC | sample_4 | isotropic | condition_2 |
3D 1H-13C NOESY-HMQC | sample_4 | isotropic | condition_2 |
2D 1H-31P | sample_4 | isotropic | condition_2 |
Software:
TOPSPIN v2.1, Bruker Biospin - collection, processing
CARA, Keller and Wuthrich - chemical shift assignment
NMR spectrometers:
- Bruker Avance 600 MHz
- Bruker Avance 700 MHz
- Bruker Avance 800 MHz
- Bruker Avance 900 MHz
- Bruker Avance 950 MHz