BMRB Entry 16980
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16980
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: RDC and RCSA refinement of an A-form RNA: Improvements in Major Groove Width PubMed: 20549304
Deposition date: 2010-06-07 Original release date: 2010-07-26
Authors: Tolbert, Blanton; Summers, Michael; Miyazaki, Yasuyuki; Barton, Shawn; Kinde, Benyam; Stark, Patrice; Singh, Rashmi; Bax, Ad; Case, David
Citation: Tolbert, Blanton; Miyazaki, Yasuyuki; Barton, Shawn; Kinde, Benyam; Starck, Patrice; Singh, Rashmi; Bax, Ad; Case, David; Summers, Michael. "Major groove width variations in RNA structures determined by NMR and impact of 13C residual chemical shift anisotropy and 1H-13C residual dipolar coupling on refinement." J. Biomol. NMR 47, 205-219 (2010).
Assembly members:
RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'), polymer, 29 residues, Formula weight is not available
Natural source: Common Name: Murine leukemia virus Taxonomy ID: 11786 Superkingdom: not available Kingdom: not available Genus/species: Gammaretrovirus not available
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'): GCGGUACUAGUUAGCUAACU
AGCUUUGUA
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 77 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')_1 | 1 |
2 | RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')_2 | 1 |
Entities:
Entity 1, RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')_1 29 residues - Formula weight is not available
1 | G | C | G | G | U | A | C | U | A | G | ||||
2 | U | U | A | G | C | U | A | A | C | U | ||||
3 | A | G | C | U | U | U | G | U | A |
Samples:
slb1: RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')0.25 1 mM; RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'), [U-100% 13C], [C-100% 13C], 0.25 mM; RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'), [G-100% 13C], [A-100% 13C], 0.25 mM; sodium chloride 150 mM; TRIS 10 mM; D2O 100%
sample_conditions_1: ionic strength: 0.15 M; pH: 6.5; pressure: 1 atm; temperature: 303 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | slb1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | slb1 | isotropic | sample_conditions_1 |
2D 1H-13C HMQC | slb1 | isotropic | sample_conditions_1 |
2D Tr 1H-13C HSQC | slb1 | isotropic | sample_conditions_1 |
2D Tr 1H-13C HSQC | slb1 | anisotropic | sample_conditions_1 |
Software:
AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm - refinement
CYANA, Guntert, Mumenthaler and Wuthrich - geometry optimization
NMR spectrometers:
- Bruker Avance 800 MHz
- Bruker DMX 600 MHz