BMRB Entry 17326
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17326
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Shin-Dalgarno sequence of the hcnA gene of Pseudomonas fluourescens PubMed: 22252483
Deposition date: 2010-11-29 Original release date: 2012-01-24
Authors: Schubert, Mario; Allain, Frederic; Aeschbacher, Thomas
Citation: Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic H-T. "A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets." J. Biomol. NMR 52, 179-190 (2012).
Assembly members:
RP1, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Pseudomonas fluorescens Taxonomy ID: 294 Superkingdom: bacteria Kingdom: not available Genus/species: Pseudomonas fluorescens
Experimental source: Production method: in vitro transcription Host organism: in vitro
Entity Sequences (FASTA):
RP1: GGGCUUCACGGAUGAAGCCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 54 |
1H chemical shifts | 60 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RP1 | 1 |
Entities:
Entity 1, RP1 20 residues - Formula weight is not available
nucleotides 1-4 and 17-20 are articifical G-C base pairs to stabilize the stem
1 | G | G | G | C | U | U | C | A | C | G | |
2 | G | A | U | G | A | A | G | C | C | C |
Samples:
sample_1: RP1 1.3 ± 0.1 mM; H2O 100%
sample_conditions_1: ionic strength: 0 M; pH: 7.4; pressure: 1 atm; temperature: 313 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
SPARKY v3.114, Goddard - chemical shift assignment
TOPSPIN v2.1, Bruker Biospin - collection, processing
NMR spectrometers:
- Bruker Avance 500 MHz