BMRB Entry 17339
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17339
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The Solution Structure of a Fungal AREA Protein-DNA Complex: An Alternative Binding Mode for a Basic Carboxyl Tail of GATA factors PubMed: 9533883
Deposition date: 2010-12-02 Original release date: 2012-06-06
Authors: Starich, Mary; Wikstrom, Mats; Arst, Herbert; Clore, G.; Gronenborn, Angela
Citation: Starich, Mary; Wikstrom, Mats; Arst, Herbert; Clore, G.; Gronenborn, Angela. "The solution structure of a fungal AREA protein-DNA complex: an alternative binding mode for the basic carboxyl tail of GATA factors." J. Mol. Biol. 277, 605-620 (1998).
Assembly members:
AREA, polymer, 66 residues, Formula weight is not available
GATA, polymer, 26 residues, Formula weight is not available
Natural source: Common Name: Aspergillus nidulans Taxonomy ID: 162425 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Aspergillus nidulans
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pET11a
Entity Sequences (FASTA):
AREA: MKNGEQNGPTTCTNCFTQTT
PLWRRNPEGQPLCNACGLFL
KLHGVVRPLSLKTDVIKKRN
RNSANS
GATA: CAGCGATAGAGACGTCGCTA
TCTCTG
- chemical_rates
Data type | Count |
kinetic rates | 1 |
binding constants | 6 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | AREA | 1 |
2 | GATA | 2 |
Entities:
Entity 1, AREA 66 residues - Formula weight is not available
1 | MET | LYS | ASN | GLY | GLU | GLN | ASN | GLY | PRO | THR | ||||
2 | THR | CYS | THR | ASN | CYS | PHE | THR | GLN | THR | THR | ||||
3 | PRO | LEU | TRP | ARG | ARG | ASN | PRO | GLU | GLY | GLN | ||||
4 | PRO | LEU | CYS | ASN | ALA | CYS | GLY | LEU | PHE | LEU | ||||
5 | LYS | LEU | HIS | GLY | VAL | VAL | ARG | PRO | LEU | SER | ||||
6 | LEU | LYS | THR | ASP | VAL | ILE | LYS | LYS | ARG | ASN | ||||
7 | ARG | ASN | SER | ALA | ASN | SER |
Entity 2, GATA 26 residues - Formula weight is not available
1 | DC | DA | DG | DC | DG | DA | DT | DA | DG | DA | ||||
2 | DG | DA | DC | DG | DT | DC | DG | DC | DT | DA | ||||
3 | DT | DC | DT | DC | DT | DG |
Samples:
sample_1: AREA, [U-15N], 2 mM; GATA 2 mM; sodium chloride 12 mM; zinc chloride 2.2 mM; sodium azide 5.0 mM; H2O 90%; D2O 10%
sample_2: AREA, [U-13C; U-15N], 2 mM; GATA 2 mM; sodium chloride 12 mM; zinc chloride 2.2 mM; sodium azide 5.0 mM; H2O 90%; D2O 10%
sample_3: AREA, [U-13C; U-15N], 2 mM; GATA 2 mM; sodium chloride 12 mM; zinc chloride 2.2 mM; sodium azide 5.0 mM; D2O 99.996%
sample_conditions_1: temperature: 298 K; pH: 6.5; pressure: 1 atm
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_1 |
Software:
NMRPipe, Johnson, One Moon Scientific - processing
PIPP, Garrett - data analysis
CAPP, Garrett - data analysis
STAPP, (Garrett et al., 1991) - data analysis
NMR spectrometers:
- Bruker AMX 500 MHz
- Bruker DMX 500 MHz
- Bruker AMX 600 MHz
- Bruker DMX 600 MHz
- Bruker DMX 750 MHz
- Bruker AMX 360 MHz