BMRB Entry 17567
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17567
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Aeschbacher, Thomas; Schubert, Mario; Allain, Frederic H-T. "A procedure to validate and correct the (13)C chemical shift calibration of RNA datasets." J. Biomol. NMR 52, 179-190 (2012).
PubMed: 22252483
Assembly members:
TASL2, polymer, 26 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: cell free synthesis Host organism: none Vector: not applicable
Entity Sequences (FASTA):
TASL2: GGGAUUCAUGCUUCGGCAUG
AAUCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 77 |
| 1H chemical shifts | 101 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | TASL2 | 1 |
Entities:
Entity 1, TASL2 26 residues - Formula weight is not available
| 1 | G | G | G | A | U | U | C | A | U | G | ||||
| 2 | C | U | U | C | G | G | C | A | U | G | ||||
| 3 | A | A | U | C | C | C |