Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17901
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Clos, Lawrence; Butcher, Samuel. "Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct." The BMRB entry is the only known published source for the data..
Assembly members:
U6_FSL_G1-29, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis Host organism: Saccharomyces cerevisiae
Entity Sequences (FASTA):
U6_FSL_G1-29: GGUUCGCGAAGUAACCCUUC
GUGGACAUUU
Data type | Count |
13C chemical shifts | 17 |
15N chemical shifts | 12 |
1H chemical shifts | 36 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | U6 snRNA | 1 |
Entity 1, U6 snRNA 30 residues - Formula weight is not available
Residue 1 was included for transcription purposes and should not be counted when comparing to S. cerevisiae U6 snRNA sequence.
1 | G | G | U | U | C | G | C | G | A | A | |
2 | G | U | A | A | C | C | C | U | U | C | |
3 | G | U | G | G | A | C | A | U | U | U |