BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17901

Title: Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct.

Deposition date: 2011-08-29 Original release date: 2011-09-28

Authors: Butcher, Samuel; Clos, Lawrence

Citation: Clos, Lawrence; Butcher, Samuel. "Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct."  The BMRB entry is the only known published source for the data..

Assembly members:
U6_FSL_G1-29, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: baker's yeast   Taxonomy ID: 4932   Superkingdom: Eukaryota   Kingdom: Fungi   Genus/species: Saccharomyces cerevisiae

Experimental source:   Production method: enzymatic semisynthesis   Host organism: Saccharomyces cerevisiae

Entity Sequences (FASTA):
U6_FSL_G1-29: GGUUCGCGAAGUAACCCUUC GUGGACAUUU

Data sets:
Data typeCount
13C chemical shifts17
15N chemical shifts12
1H chemical shifts36

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1U6 snRNA1

Entities:

Entity 1, U6 snRNA 30 residues - Formula weight is not available

Residue 1 was included for transcription purposes and should not be counted when comparing to S. cerevisiae U6 snRNA sequence.

1   GGUUCGCGAA
2   GUAACCCUUC
3   GUGGACAUUU

Samples:

sample_1: U6 FSL G1-29, [U-13C; U-15N], 1.5 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 15 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1

Software:

xwinnmr v3.5, Bruker Biospin - collection, processing

SPARKY v3.114, Goddard - chemical shift assignment, data analysis, peak picking

NMR spectrometers:

  • Bruker Avance 750 MHz
  • Bruker DMX 600 MHz