BMRB Entry 17921
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17921
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant.
Deposition date: 2011-09-06 Original release date: 2012-02-08
Authors: Vander Muelen, Kirk; Davis, Jared; Clos, Lawrence; Butcher, Samuel
Citation: Vander Muelen, Kirk; Davis, Jared; Clos, Lawrence; Butcher, Samuel. "Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant." The BMRB entry is the only known published source for the data..
Assembly members:
TECTO47, polymer, 47 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
TECTO47: GGAGGAUAUGGAAGAACCGG
GGUGACUUGGUUCUUCCUAA
GUCCUCC
- assigned_chemical_shifts
Data type | Count |
15N chemical shifts | 22 |
1H chemical shifts | 32 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | GAAA tetraloop monomer | 1 |
Entities:
Entity 1, GAAA tetraloop monomer 47 residues - Formula weight is not available
1 | G | G | A | G | G | A | U | A | U | G | ||||
2 | G | A | A | G | A | A | C | C | G | G | ||||
3 | G | G | U | G | A | C | U | U | G | G | ||||
4 | U | U | C | U | U | C | C | U | A | A | ||||
5 | G | U | C | C | U | C | C |
Samples:
sample_unlabeled: TECTO47 1 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%
sample_labeled: TECTO47, [U-100% 13C; U-100% 15N], 1 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 15 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-15N HSQC | sample_labeled | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_unlabeled | isotropic | sample_conditions_1 |
Software:
xwinnmr v3.5, Bruker Biospin - collection, processing
SPARKY v3.114, Goddard - chemical shift assignment, data analysis, peak picking
NMR spectrometers:
- Bruker Avance 600 MHz
- Bruker DMX 750 MHz
- Varian INOVA 900 MHz