BMRB Entry 17921
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17921
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vander Muelen, Kirk; Davis, Jared; Clos, Lawrence; Butcher, Samuel. "Partial 1H, 15N Chemical Shift Assignments of a GAAA Tetraloop Receptor Variant." The BMRB entry is the only known published source for the data..
Assembly members:
TECTO47, polymer, 47 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
TECTO47: GGAGGAUAUGGAAGAACCGG
GGUGACUUGGUUCUUCCUAA
GUCCUCC
- assigned_chemical_shifts
| Data type | Count |
| 15N chemical shifts | 22 |
| 1H chemical shifts | 32 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | GAAA tetraloop monomer | 1 |
Entities:
Entity 1, GAAA tetraloop monomer 47 residues - Formula weight is not available
| 1 | G | G | A | G | G | A | U | A | U | G | ||||
| 2 | G | A | A | G | A | A | C | C | G | G | ||||
| 3 | G | G | U | G | A | C | U | U | G | G | ||||
| 4 | U | U | C | U | U | C | C | U | A | A | ||||
| 5 | G | U | C | C | U | C | C |