BMRB Entry 19448

Title:
Structural studies on dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence
Deposition date:
2013-08-22
Original release date:
2013-10-14
Authors:
Williamson, Mike; Wilson, Tom; Thomas, James; Felix, Vitor; Costa, Paolo
Citation:

Citation: Wilson, Tom; Costa, Paulo; Felix, Vitor; Williamson, Mike; Thomas, Jim. "Structural Studies on Dinuclear Ruthenium(II) Complexes That Bind Diastereoselectively to an Antiparallel Folded Human Telomere Sequence."  J. Med. Chem. 56, 8674-8683 (2013).
PubMed: 24088028

Assembly members:

Assembly members:
human_telomere_quadruplex, polymer, 22 residues, Formula weight is not available
entity_2FJ, non-polymer, 1211.268 Da.
entity_NA, non-polymer, 22.990 Da.

Natural source:

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
human_telomere_quadruplex: AGGGTTAGGGTTAGGGTTAG GG

Data sets:
Data typeCount
1H chemical shifts196

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1human telomere quadruplex1
2LL-(Ru[bipy]2)tppz4+, ligand2
3Na+, 13
4Na+, 23

Entities:

Entity 1, human telomere quadruplex 22 residues - Formula weight is not available

1   DADGDGDGDTDTDADGDGDG
2   DTDTDADGDGDGDTDTDADG
3   DGDG

Entity 2, LL-(Ru[bipy]2)tppz4+, ligand - C64 H44 N14 Ru2 - 1211.268 Da.

1   2FJ

Entity 3, Na+, 1 - Na - 22.990 Da.

1   NA