BMRB Entry 19887
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19887
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: oligonucleotide model of miR-21 pre-element PubMed: 25250627
Deposition date: 2014-04-02 Original release date: 2014-09-29
Authors: Chirayil, Sara; Wu, Qiong; Amezcua, Carlos; Luebke, Kevin
Citation: Chirayil, Sara; Wu, Qiong; Amezcua, Carlos; Luebke, Kevin. "NMR Characterization of an Oligonucleotide Model of the MiR-21 Pre-Element" PLOS ONE 9, e108231-e108231 (2014).
Assembly members:
miR-21_pre-element, polymer, 29 residues, 111.103 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: obtained from a vendor
Entity Sequences (FASTA):
miR-21_pre-element: GGGUUGACCGUUGAAUCUCA
CGGCAACCC
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 100 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | miR-21 pre-element | 1 |
Entities:
Entity 1, miR-21 pre-element 29 residues - 111.103 Da.
1 | G | G | G | U | U | G | A | C | C | G | ||||
2 | U | U | G | A | A | U | C | U | C | A | ||||
3 | C | G | G | C | A | A | C | C | C |
Samples:
sample_1: miR-21 pre-element 1 mM; H2O 90%; D2O 10%
sample_conditions_1: temperature: 273 K; pH: 6.7; pressure: 1 atm; ionic strength: 10 mM
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
Software:
CNS v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution
NMR spectrometers:
- Varian INOVA 600 MHz
- Varian INOVA 800 MHz