BMRB Entry 25364
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR25364
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Backbone 1H, 13C, and 15N Chemical Shift Assignments drosophila stem-loop binding protein complexed with histone mRNA stem-loop PubMed: 25002523
Deposition date: 2014-11-24 Original release date: 2014-12-09
Authors: Zhang, Jun; Tan, Dazhi; DeRose, Eugene; Perera, Lalith; Dominski, Zbigniew; Marzluff, William; Tong, Liang; Hall, Traci
Citation: Zhang, Jun; Derose, Eugene; Perera, Lalith; Dominski, Zbigniew; Marzluff, William; Tong, Liang; Hall, Traci. "Molecular mechanisms for the regulation of histone mRNA stem-loop binding protein by phosphorylation" Proc. Natl. Acad. Sci. U.S.A. 111, E2937-E2946 (2014).
Assembly members:
SLBP, polymer, 93 residues, Formula weight is not available
RNA, polymer, 28 residues, Formula weight is not available
Natural source: Common Name: fruit fly Taxonomy ID: 7227 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Drosophila melanogaster
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: PSMT3
Entity Sequences (FASTA):
SLBP: SSSYTEADPAILSRRQKQID
YGKNTAAYERYVEMVPKDER
TRDHPREPNKYGKYSRRAFD
GLVKIWRKSLHIYDPPTQAR
DTAKDENEDEDED
RNA: GGCCAAAGGCCCUUUUCAGG
GCCACCCA
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 148 |
1H chemical shifts | 62 |
15N chemical shifts | 62 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | SLBP | 1 |
2 | RNA | 2 |
Entities:
Entity 1, SLBP 93 residues - Formula weight is not available
1 | SER | SER | SER | TYR | THR | GLU | ALA | ASP | PRO | ALA | ||||
2 | ILE | LEU | SER | ARG | ARG | GLN | LYS | GLN | ILE | ASP | ||||
3 | TYR | GLY | LYS | ASN | THR | ALA | ALA | TYR | GLU | ARG | ||||
4 | TYR | VAL | GLU | MET | VAL | PRO | LYS | ASP | GLU | ARG | ||||
5 | THR | ARG | ASP | HIS | PRO | ARG | GLU | PRO | ASN | LYS | ||||
6 | TYR | GLY | LYS | TYR | SER | ARG | ARG | ALA | PHE | ASP | ||||
7 | GLY | LEU | VAL | LYS | ILE | TRP | ARG | LYS | SER | LEU | ||||
8 | HIS | ILE | TYR | ASP | PRO | PRO | THR | GLN | ALA | ARG | ||||
9 | ASP | THR | ALA | LYS | ASP | GLU | ASN | GLU | ASP | GLU | ||||
10 | ASP | GLU | ASP |
Entity 2, RNA 28 residues - Formula weight is not available
1 | G | G | C | C | A | A | A | G | G | C | ||||
2 | C | C | U | U | U | U | C | A | G | G | ||||
3 | G | C | C | A | C | C | C | A |
Samples:
sample_1: SLBP, [U-100% 13C; U-100% 15N], 0.8 mM; Hepes 20 mM; NaCl 300 mM
sample_conditions_1: temperature: 273 K; pH: 7.5; pressure: 1 atm; ionic strength: 300 mM
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
3D HNCO | sample_1 | isotropic | sample_conditions_1 |
3D CBCA(CO)NH | sample_1 | isotropic | sample_conditions_1 |
3D HNCACB | sample_1 | isotropic | sample_conditions_1 |
3D HNCA | sample_1 | isotropic | sample_conditions_1 |
Software:
NMRView, Johnson, One Moon Scientific - chemical shift assignment
NMR spectrometers:
- Varian INOVA 600 MHz
Related Database Links:
BMRB | 25365 |
PDB | |
GB | AAF56867 AAF71752 AAG16723 AAL90413 AAM50696 |
REF | NP_477480 |
SP | Q9VAN6 |
AlphaFold | Q9VAN6 |
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts