BMRB Entry 25416
Click here to enlarge.
PDB ID: 2mxl
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25416
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Chen, Jonathan; Kennedy, Scott; Turner, Douglas. "Structural features of a 3' splice site in influenza A" Biochemistry 54, 3269-3285 (2015).
PubMed: 25909229
Assembly members:
RNA_(39-MER), polymer, 39 residues, 12688.705 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: cell free synthesis Host organism: E. coli - cell free Vector: pUC18
Entity Sequences (FASTA):
RNA_(39-MER): GGAUUUGCAGGCCUACCAGA
AACGGAUGGGAGUGCAGAU
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 166 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity | 1 |
Entities:
Entity 1, entity 39 residues - 12688.705 Da.
| 1 | G | G | A | U | U | U | G | C | A | G | ||||
| 2 | G | C | C | U | A | C | C | A | G | A | ||||
| 3 | A | A | C | G | G | A | U | G | G | G | ||||
| 4 | A | G | U | G | C | A | G | A | U |