BMRB Entry 26505

Name: 13C NMR Relaxation Studies of RNA Base and Ribose Nuclei Reveal a Complex Pattern of Motions in the RNA Binding Site for Human U1A Protein
Published: 2015-02-11

Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26505

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title: 13C NMR Relaxation Studies of RNA Base and Ribose Nuclei Reveal a Complex Pattern of Motions in the RNA Binding Site for Human U1A Protein PubMed: 15890361

Deposition date: 2015-01-22 Original release date: 2015-02-11

Authors: Shajani, Zahra; Varani, Gabriele

Citation: Shajani, Zahra; Varani, Gabriele. "13C NMR Relaxation Studies of RNA Base and Ribose Nuclei Reveal a Complex Pattern of Motions in the RNA" J. Mol. Biol. 349, 699-715 (2005).

Assembly members:
3'-UTR, polymer, 30 residues, Formula weight is not available

Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens

Experimental source: Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
3'-UTR: GGCAGAGUCCUUCGGGACAU UGCACCUGCC

Data sets:

heteronucl_NOEs
- heteronuclear_noe_list_1
- heteronuclear_noe_list_2
heteronucl_T1_relaxation
- heteronuclear_T1_list_1
- heteronuclear_T1_list_2
heteronucl_T1rho_relaxation
- heteronuclear_T1rho_list_1
- heteronuclear_T1rho_list_2
order_parameters
- order_parameter_list_1
- order_parameter_list_2

Data type	Count
heteronuclear NOE values	97
T1 relaxation values	98
T1rho relaxation values	98
order parameters	65

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	3'-untranslated region	1

Entities:

Entity 1, 3'-untranslated region 30 residues - Formula weight is not available

1	G	G	C	A	G	A	G	U	C	C
2	U	U	C	G	G	G	A	C	A	U
3	U	G	C	A	C	C	U	G	C	C

Samples:

sample_1: 3'-UTR, [U-13C; U-15N], 0.7 mM; potassium phosphate 10 mM; EDTA .01 mM; H2O 99.9 v/v; D20 .1 v/v

sample_2: 3'-UTR, [U-13C; U-15N], 1.0 mM; potassium phosphate 10 mM; EDTA .01 mM; H2O 99.9 v/v; D20 .1 v/v

sample_conditions_1: temperature: 298 K; pH: 6.0; pressure: 1.0 atm

Experiments:

Name	Sample	Sample state	Sample conditions
2D 1H-13C HSQC	sample_1	isotropic	sample_conditions_1
2D 1H-13C HSQC	sample_1	isotropic	sample_conditions_1
2D 1H-1H NOESY	sample_1	isotropic	sample_conditions_1
2D 1H-1H NOESY	sample_1	isotropic	sample_conditions_1
13C-{1H} NOE	sample_1	isotropic	sample_conditions_1
13C-{1H} NOE	sample_1	isotropic	sample_conditions_1

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

ModelFree, Palmer - data analysis

NMR spectrometers:

Bruker Avance 500 MHz
Bruker DRX 750 MHz