BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27173

Title: 1H, 13C, and 15N resonance assignments of a 22mer G-quadruplex forming within KRAS oncogene promoter region at physiological temperature   PubMed: 29189986

Deposition date: 2017-07-12 Original release date: 2017-07-20

Authors: Marquevielle, Julien; Kumar M.V., Vasantha; Mergny, Jean-Louis; Salgado, Gilmar F.

Citation: Marquevielle, Julien; Kumar M.V., Vasantha; Mergny, Jean-Louis; Salgado, Gilmar F.. "1H, 13C, and 15N chemical shift assignments of a G-quadruplex forming sequence within the KRAS proto-oncogene promoter region"  Biomol. NMR Assignments 12, 123-127 (2018).

Assembly members:
KRAS22RT, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
KRAS22RT: AGGGCGGTGTGGGAATAGGG AA

Data sets:
Data typeCount
13C chemical shifts136
15N chemical shifts12
1H chemical shifts203

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1KRAS promoter region G-quadruplex1

Entities:

Entity 1, KRAS promoter region G-quadruplex 22 residues - Formula weight is not available

1   DADGDGDGDCDGDGDTDGDT
2   DGDGDGDADADTDADGDGDG
3   DADA

Samples:

sample_1: KRAS22RT 2.5 mM

Buffer_1X: pH: 6.66; pressure: 1 atm; temperature: 310 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicBuffer_1X
2D 1H-13C HSQCsample_1isotropicBuffer_1X
2D 1H-13C HSQC aromaticsample_1isotropicBuffer_1X

Software:

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 950 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 700 MHz