BMRB Entry 27173
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27173
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 1H, 13C, and 15N resonance assignments of a 22mer G-quadruplex forming within KRAS oncogene promoter region at physiological temperature PubMed: 29189986
Deposition date: 2017-07-12 Original release date: 2017-07-20
Authors: Marquevielle, Julien; Kumar M.V., Vasantha; Mergny, Jean-Louis; Salgado, Gilmar F.
Citation: Marquevielle, Julien; Kumar M.V., Vasantha; Mergny, Jean-Louis; Salgado, Gilmar F.. "1H, 13C, and 15N chemical shift assignments of a G-quadruplex forming sequence within the KRAS proto-oncogene promoter region" Biomol. NMR Assignments 12, 123-127 (2018).
Assembly members:
KRAS22RT, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
KRAS22RT: AGGGCGGTGTGGGAATAGGG
AA
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 136 |
15N chemical shifts | 12 |
1H chemical shifts | 203 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | KRAS promoter region G-quadruplex | 1 |
Entities:
Entity 1, KRAS promoter region G-quadruplex 22 residues - Formula weight is not available
1 | DA | DG | DG | DG | DC | DG | DG | DT | DG | DT | ||||
2 | DG | DG | DG | DA | DA | DT | DA | DG | DG | DG | ||||
3 | DA | DA |
Samples:
sample_1: KRAS22RT 2.5 mM
Buffer_1X: pH: 6.66; pressure: 1 atm; temperature: 310 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-15N HSQC | sample_1 | isotropic | Buffer_1X |
2D 1H-13C HSQC | sample_1 | isotropic | Buffer_1X |
2D 1H-13C HSQC aromatic | sample_1 | isotropic | Buffer_1X |
Software:
SPARKY, Goddard - chemical shift assignment
NMR spectrometers:
- Bruker Avance 950 MHz
- Bruker Avance 800 MHz
- Bruker Avance 700 MHz