BMRB Entry 27225
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27225
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Baronti, Lorenzo; Guzzetti, Ileana; Ebrahimi, Parisa; Friebe Sandoz, Sarah; Steiner, Emilie; Schlagnitweit, Judith; Fromm, Bastian; Silva, Luis; Fontana, Carolina; Chen, Alan; Petzold, Katja. "Base-pair Conformational Switch Modulates miR-34a Targeting of Sirt1 mRNA" Nature 583, 139-144 (2020).
PubMed: 32461691
Assembly members:
hsa-miR-34a-5p, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis Host organism: T7 in vitro transcritpion Vector: DNA template
Entity Sequences (FASTA):
hsa-miR-34a-5p: UGGCAGUGUCUUAGCUGGUU
GU
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 44 |
| 15N chemical shifts | 27 |
| 1H chemical shifts | 53 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | monomer hsa-miR-34a-5p | 1 |
Entities:
Entity 1, monomer hsa-miR-34a-5p 22 residues - Formula weight is not available
| 1 | U | G | G | C | A | G | U | G | U | C | ||||
| 2 | U | U | A | G | C | U | G | G | U | U | ||||
| 3 | G | U |
Related Database Links:
| NCBI | GenBank: LM378896.1 |