BMRB Entry 27226
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27226
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Baronti, Lorenzo; Guzzetti, Ileana; Ebrahimi, Parisa; Friebe Sandoz, Sarah; Steiner, Emilie; Schlagnitweit, Judith; Fromm, Bastian; Silva, Luis; Fontana, Carolina; Chen, Alan; Petzold, Katja. "Base-pair Conformational Switch Modulates miR-34a Targeting of Sirt1 mRNA" Nature 583, 139-144 (2020).
PubMed: 32461691
Assembly members:
hsa-miR-34a-mSIRT1_bulge, polymer, 28 residues, 8458.4 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis Host organism: T7 in vitro transcritpion Vector: DNA template
Entity Sequences (FASTA):
hsa-miR-34a-mSIRT1_bulge: GGCACCAUUACUGCUUCGGC
AGUGUGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 67 |
| 15N chemical shifts | 54 |
| 1H chemical shifts | 94 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | hsa-miR-34a-mSIRT1_bulge | 1 |
Entities:
Entity 1, hsa-miR-34a-mSIRT1_bulge 28 residues - 8458.4 Da.
Nts 14-19 constitute a synthetic cUUCGg motif. Nts 1-3 and 26-28 synthetic closing stem. Nts 20-25 hsa-miR-34a-5p and nts 4-13 mSIRT1 side of the hetero-duplex, respectively.
| 1 | G | G | C | A | C | C | A | U | U | A | ||||
| 2 | C | U | G | C | U | U | C | G | G | C | ||||
| 3 | A | G | U | G | U | G | C | C |