Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27229
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Baronti, Lorenzo; Guzzetti, Ileana; Ebrahimi, Parisa; Friebe Sandoz, Sarah; Steiner, Emilie; Schlagnitweit, Judith; Fromm, Bastian; Silva, Luis; Fontana, Carolina; Chen, Alan; Petzold, Katja. "Base-pair Conformational Switch Modulates miR-34a Targeting of Sirt1 mRNA" Nature 583, 139-144 (2020).
PubMed: 32461691
Assembly members:
hsa-miR-34a-mSIRT1_bulge_U5C9mut, polymer, 28 residues, 8458.4 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis Host organism: T7 in vitro transcritpion Vector: DNA template
Entity Sequences (FASTA):
hsa-miR-34a-mSIRT1_bulge_U5C9mut: GGCAUCAUCACUGCUUCGGC
AGUGUGCC
Data type | Count |
13C chemical shifts | 71 |
15N chemical shifts | 41 |
1H chemical shifts | 90 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | hsa-miR-34a-mSIRT1 bulge U5C9mut | 1 |
Entity 1, hsa-miR-34a-mSIRT1 bulge U5C9mut 28 residues - 8458.4 Da.
Nts 14-19 constitute a synthetic cUUCGg motif. Nts 1-3 and 26-28 synthetic closing stem. Nts 20-25 hsa-miR-34a-5p and nts 4-13 mSIRT1 side of the mutated hetero-duplex, respectively.
1 | G | G | C | A | U | C | A | U | C | A | ||||
2 | C | U | G | C | U | U | C | G | G | C | ||||
3 | A | G | U | G | U | G | C | C |