BMRB Entry 27229
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27229
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: hsa-miR-34a-mSIRT1 bulge U5C9mut PubMed: 32461691
Deposition date: 2017-08-22 Original release date: 2020-05-21
Authors: Baronti, Lorenzo; Steiner, Emilie; Schlagnitweit, Judith; Petzold, Katja
Citation: Baronti, Lorenzo; Guzzetti, Ileana; Ebrahimi, Parisa; Friebe Sandoz, Sarah; Steiner, Emilie; Schlagnitweit, Judith; Fromm, Bastian; Silva, Luis; Fontana, Carolina; Chen, Alan; Petzold, Katja. "Base-pair Conformational Switch Modulates miR-34a Targeting of Sirt1 mRNA" Nature 583, 139-144 (2020).
Assembly members:
hsa-miR-34a-mSIRT1_bulge_U5C9mut, polymer, 28 residues, 8458.4 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis Host organism: T7 in vitro transcritpion Vector: DNA template
Entity Sequences (FASTA):
hsa-miR-34a-mSIRT1_bulge_U5C9mut: GGCAUCAUCACUGCUUCGGC
AGUGUGCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 71 |
15N chemical shifts | 41 |
1H chemical shifts | 90 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | hsa-miR-34a-mSIRT1 bulge U5C9mut | 1 |
Entities:
Entity 1, hsa-miR-34a-mSIRT1 bulge U5C9mut 28 residues - 8458.4 Da.
Nts 14-19 constitute a synthetic cUUCGg motif. Nts 1-3 and 26-28 synthetic closing stem. Nts 20-25 hsa-miR-34a-5p and nts 4-13 mSIRT1 side of the mutated hetero-duplex, respectively.
1 | G | G | C | A | U | C | A | U | C | A | ||||
2 | C | U | G | C | U | U | C | G | G | C | ||||
3 | A | G | U | G | U | G | C | C |
Samples:
sample_1: hsa-miR-34a-mSIRT1 bulge U5C9mut, [U-100% 13C; U-100% 15N], 750 uM; H2O 90%; D2O, [U-2H], 10%; sodium phosphate 15 mM; sodium chloride 25 mM; EDTA 0.1 mM
sample_conditions_1: pH: 6.5; pressure: 1 atm; temperature: 295.4 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D HNN COSY | sample_1 | isotropic | sample_conditions_1 |
3D HCN | sample_1 | isotropic | sample_conditions_1 |
Software:
TOPSPIN vv 3.2, Bruker Biospin - processing
SPARKY, Goddard - chemical shift assignment
NMR spectrometers:
- Bruker Avance III HD 600 MHz