BMRB Entry 27652
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27652
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NZ118
Deposition date: 2018-10-16 Original release date: 2020-05-29
Authors: Jing, Haitao; Fu, Wenqiang
Citation: Jing, Haitao; Fu, Wenqiang. "1H Assigned Chemical Shifts for NZ118" .
Assembly members:
NZ118, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
NZ118: GGGTTAGGGTTAGGGTTAGG
GTTA
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 111 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | NZ118, Chain A | 1 |
2 | NZ118, Chain B | 1 |
3 | NZ118, Chain C | 1 |
4 | NZ118, Chain D | 1 |
Entities:
Entity 1, NZ118, Chain A 24 residues - Formula weight is not available
1 | DG | DG | DG | DT | DT | DA | DG | DG | DG | DT | ||||
2 | DT | DA | DG | DG | DG | DT | DT | DA | DG | DG | ||||
3 | DG | DT | DT | DA |
Samples:
sample_1: NZ118 6 mM; potassium phosphate 5 mM
sample_conditions_1: pH: 6.8; temperature: 315 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
X-PLOR_NIH v2.46, Schwieters, Kuszewski, Tjandra and Clore - structure solution
NMR spectrometers:
- Bruker Avance 850 MHz