Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27794
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wolter, Antje; Pianu, Angela; Kremser, Johannes; Strebitzer, Elisabeth; Schnieders, Robbin; Fuertig, Boris; Kreutz, Christoph; Duchardt-Ferner, Elke; Woehnert, Jens. "NMR resonance assignments for the GTP-binding RNA aptamer 9-12 in complex with GTP" Biomol. NMR Assignments ., .-. (2019).
PubMed: 31030336
Assembly members:
GTP_9-12_aptamer, polymer, 39 residues, Formula weight is not available
entity_GTP, non-polymer, 523.180 Da.
entity_MG, non-polymer, 24.305 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: in vitro transcription Host organism: Escherichia coli, cell free Vector: pSP64
Entity Sequences (FASTA):
GTP_9-12_aptamer: GGGAGCAGUUCAGGUAACCA
CGUAAGAUACGGUGCUCCC
Data type | Count |
13C chemical shifts | 324 |
15N chemical shifts | 146 |
1H chemical shifts | 351 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA | 1 |
2 | ligand | 2 |
3 | Mg | 3 |
Entity 1, RNA 39 residues - Formula weight is not available
1 | G | G | G | A | G | C | A | G | U | U | ||||
2 | C | A | G | G | U | A | A | C | C | A | ||||
3 | C | G | U | A | A | G | A | U | A | C | ||||
4 | G | G | U | G | C | U | C | C | C |
Entity 2, ligand - C10 H16 N5 O14 P3 - 523.180 Da.
1 | GTP |
Entity 3, Mg - Mg - 24.305 Da.
1 | MG |