Click here to enlarge.
PDB ID: 6mci
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30512
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Pham, V.; Salguero, C.; Khan, S.; Meagher, J.; Brown, W.; Humbert, N.; de Rocquigny, H.; Smith, J.; D'Souza, V.. "HIV-1 Tat interactions with cellular 7SK and viral TAR RNAs identifies dual structural mimicry" Nat. Commun. 9, 4266-4266 (2018).
PubMed: 30323330
Assembly members:
entity_1, polymer, 57 residues, 18358.910 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGAUCUGUCACCCCAUUGA
UCGCCGAGAGGCUGAUCUGG
XUGGXUAGGCGGGUCCC
Data type | Count |
13C chemical shifts | 49 |
15N chemical shifts | 27 |
1H chemical shifts | 207 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 57 residues - 18358.910 Da.
1 | G | G | G | A | U | C | U | G | U | C | ||||
2 | A | C | C | C | C | A | U | U | G | A | ||||
3 | U | C | G | C | C | G | A | G | A | G | ||||
4 | G | C | U | G | A | U | C | U | G | G | ||||
5 | RY | U | G | G | RY | U | A | G | G | C | ||||
6 | G | G | G | U | C | C | C |