BMRB Entry 30512
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30512
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of 7SK stem-loop 1 PubMed: 30323330
Deposition date: 2018-08-31 Original release date: 2018-10-24
Authors: Pham, V.; D'Souza, V.
Citation: Pham, V.; Salguero, C.; Khan, S.; Meagher, J.; Brown, W.; Humbert, N.; de Rocquigny, H.; Smith, J.; D'Souza, V.. "HIV-1 Tat interactions with cellular 7SK and viral TAR RNAs identifies dual structural mimicry" Nat. Commun. 9, 4266-4266 (2018).
Assembly members:
entity_1, polymer, 57 residues, 18358.910 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGAUCUGUCACCCCAUUGA
UCGCCGAGAGGCUGAUCUGG
XUGGXUAGGCGGGUCCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 49 |
15N chemical shifts | 27 |
1H chemical shifts | 207 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 57 residues - 18358.910 Da.
1 | G | G | G | A | U | C | U | G | U | C | ||||
2 | A | C | C | C | C | A | U | U | G | A | ||||
3 | U | C | G | C | C | G | A | G | A | G | ||||
4 | G | C | U | G | A | U | C | U | G | G | ||||
5 | RY | U | G | G | RY | U | A | G | G | C | ||||
6 | G | G | G | U | C | C | C |
Samples:
sample_1: 7SK RNA 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_2: 7SK RNA, [U-13C; U-15N], 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_3: 7SK RNA, [U-13C; U-15N], 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_4: 7SK RNA 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_conditions_1: ionic strength: 80 mM; pH: 5.4; pressure: 100000 Pa; temperature: 283 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_3 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_4 | isotropic | sample_conditions_1 |
Software:
TOPSPIN, Bruker Biospin - collection
NMRView, Johnson, One Moon Scientific - chemical shift assignment, peak picking
CYANA, Guntert, Mumenthaler and Wuthrich - data analysis, processing, structure calculation
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement
NMR spectrometers:
- Bruker DMX 700 MHz