BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30577

Title: NMR structure of the 2:1 complex of a carbazole derivative BMVC bound to c-MYC G-quadruplex   PubMed: 31740959

Deposition date: 2019-02-24 Original release date: 2019-10-18

Authors: Lin, C.; Liu, W.; Yang, D.

Citation: Liu, Wenting; Lin, Clement; Wu, Guanhui; Dai, Jixun; Chang, Ta-Chau; Yang, Danzhou. "Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition"  Nucleic Acids Res. 47, 11931-11942 (2019).

Assembly members:
entity_1, polymer, 22 residues, 7008.510 Da.
entity_BO6, non-polymer, 403.518 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: TGAGGGTGGGTAGGGTGGGT AA

Data sets:
Data typeCount
1H chemical shifts253

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_2, 12
3entity_2, 22

Entities:

Entity 1, entity_1 22 residues - 7008.510 Da.

1   DTDGDADGDGDGDTDGDGDG
2   DTDADGDGDGDTDGDGDGDT
3   DADA

Entity 2, entity_2, 1 - C28 H25 N3 - 403.518 Da.

1   BO6

Samples:

sample_1: DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3') 2 mM; BMVC 3 mM; potassium phosphate 25 mM; potassium chloride 70 mM

sample_conditions_1: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1

Software:

X-PLOR, Brunger - refinement

InsightII, Accelrys Software Inc. - refinement, structure calculation

SPARKY, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker DRX 600 MHz