BMRB Entry 30701
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30701
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 61 nt human Hepatitis B virus epsilon pre-genomic RNA PubMed: 34155954
Deposition date: 2019-12-17 Original release date: 2020-12-26
Authors: LeBlanc, R.; Kasprzak, W.; Longhini, A.; Abulwerdi, F.; Ginocchio, S.; Shields, B.; Nyman, J.; Svirydava, M.; Del Vecchio, C.; Ivanic, J.; Schneekloth, J.; Dayie, T.; Shapiro, B.; Le Grice, S.
Citation: LeBlanc, Regan; Kasprzak, Wojciech; Longhini, Andrew; Olenginski, Lukasz; Abulwerdi, Fardokht; Ginocchio, Stefano; Shields, Brigit; Nyman, Julie; Svirydava, Maryia; Del Vecchio, Claudia; Ivanic, Joseph; Schneekloth, John; Shapiro, Bruce; Dayie, Theodore Kwaku; Le Grice, Stuart. "Structural insights of the conserved "priming loop" of hepatitis B virus pre-genomic RNA" J. Biomol. Struct. Dyn. 40, 9761-9773 (2022).
Assembly members:
entity_1, polymer, 61 residues, 19541.488 Da.
Natural source: Common Name: HBV Taxonomy ID: 10407 Superkingdom: Viruses Kingdom: not available Genus/species: Orthohepadnavirus HBV
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUUCAUGUCCUACUGUUCA
AGCCUCCAAGCUGUGCCUUG
GGUGGCUUUGGGGCAUGGAC
C
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 164 |
15N chemical shifts | 27 |
1H chemical shifts | 283 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 61 residues - 19541.488 Da.
1 | G | G | U | U | C | A | U | G | U | C | ||||
2 | C | U | A | C | U | G | U | U | C | A | ||||
3 | A | G | C | C | U | C | C | A | A | G | ||||
4 | C | U | G | U | G | C | C | U | U | G | ||||
5 | G | G | U | G | G | C | U | U | U | G | ||||
6 | G | G | G | C | A | U | G | G | A | C | ||||
7 | C |
Samples:
sample_1: RNA (61-MER), [U-13C; U-15N], 0.8 mM
sample_2: RNA (61-MER), [U-13C; U-15N], 0.8 mM
sample_3: RNA (61-MER), 13C-selective, 0.7 mM
sample_conditions_1: ionic strength: 10 mM; pH: 6.4; pressure: 1 atm; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC aliphatic | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
3D 1H-15N NOESY | sample_2 | isotropic | sample_conditions_1 |
3D 1H-13C NOESY aliphatic | sample_1 | isotropic | sample_conditions_1 |
3D 1H-13C NOESY aromatic | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
3D HCN | sample_1 | isotropic | sample_conditions_1 |
2D HNCCNCH | sample_2 | isotropic | sample_conditions_1 |
Filter/Edit NOESY | sample_3 | isotropic | sample_conditions_1 |
Software:
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
NMRView, Johnson, One Moon Scientific - chemical shift assignment, peak picking
NMR spectrometers:
- Bruker Ascend 800 MHz
- Bruker Ultrashield Plus 600 MHz