BMRB Entry 30701
Click here to enlarge.
PDB ID: 6var
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30701
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: LeBlanc, Regan; Kasprzak, Wojciech; Longhini, Andrew; Olenginski, Lukasz; Abulwerdi, Fardokht; Ginocchio, Stefano; Shields, Brigit; Nyman, Julie; Svirydava, Maryia; Del Vecchio, Claudia; Ivanic, Joseph; Schneekloth, John; Shapiro, Bruce; Dayie, Theodore Kwaku; Le Grice, Stuart. "Structural insights of the conserved "priming loop" of hepatitis B virus pre-genomic RNA" J. Biomol. Struct. Dyn. 40, 9761-9773 (2022).
PubMed: 34155954
Assembly members:
entity_1, polymer, 61 residues, 19541.488 Da.
Natural source: Common Name: HBV Taxonomy ID: 10407 Superkingdom: Viruses Kingdom: not available Genus/species: Orthohepadnavirus HBV
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUUCAUGUCCUACUGUUCA
AGCCUCCAAGCUGUGCCUUG
GGUGGCUUUGGGGCAUGGAC
C
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 164 |
| 15N chemical shifts | 27 |
| 1H chemical shifts | 283 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 61 residues - 19541.488 Da.
| 1 | G | G | U | U | C | A | U | G | U | C | ||||
| 2 | C | U | A | C | U | G | U | U | C | A | ||||
| 3 | A | G | C | C | U | C | C | A | A | G | ||||
| 4 | C | U | G | U | G | C | C | U | U | G | ||||
| 5 | G | G | U | G | G | C | U | U | U | G | ||||
| 6 | G | G | G | C | A | U | G | G | A | C | ||||
| 7 | C |