BMRB Entry 30923
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30923
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the MYC promoter G-quadruplex in complex with berberine: conformer A PubMed: 34677968
Deposition date: 2021-06-10 Original release date: 2021-10-30
Authors: Dickerhoff, J.; Yang, D.
Citation: Dickerhoff, J.; Brundridge, N.; McLuckey, S.; Yang, D.. "Berberine Molecular Recognition of the Parallel MYC G-Quadruplex in Solution" J. Med. Chem. 64, 16205-16212 (2021).
Assembly members:
entity_1, polymer, 22 residues, 7033.523 Da.
entity_BER, non-polymer, 336.361 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGAGGGTGGGTAGGGTGGGG
AA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 27 |
| 1H chemical shifts | 222 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
| 3 | unit_3 | 2 |
Entities:
Entity 1, unit_1 22 residues - 7033.523 Da.
| 1 | DT | DG | DA | DG | DG | DG | DT | DG | DG | DG | ||||
| 2 | DT | DA | DG | DG | DG | DT | DG | DG | DG | DG | ||||
| 3 | DA | DA |
Entity 2, unit_2 - C20 H18 N O4 - 336.361 Da.
| 1 | BER |
Samples:
sample_1: DNA 1.2 mM; Berberine 3.6 mM; potassium phosphate 10 mM
sample_conditions_1: ionic strength: 10 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 10 mM; pH: 7; pressure: 1 atm; temperature: 308 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
Software:
Amber v16, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - structure calculation
X-PLOR NIH v2.48, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
CcpNmr Analysis v2.4, CCPN - chemical shift assignment, peak picking
TopSpin, Bruker Biospin - processing
NMR spectrometers:
- Bruker AVANCE III 800 MHz