BMRB Entry 30942
Click here to enlarge.
PDB ID: 7rwr
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30942
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Samuelian, John; Gremminger, Thomas; Song, Zhenwei; Poudyal, Raghav; Li, Jun; Zhou, Yuanzhe; Staller, Seth; Carballo, Johan; Roychowdhury-Saha, Manami; Chen, Shi-Jie; Burke, Donald; Heng, Xiao; Baum, Dana. "An RNA aptamer that shifts the reduction potential of metabolic cofactors" Nat. Chem. Biol. 18, 1263-1269 (2022).
PubMed: 36097297
Assembly members:
entity_1, polymer, 38 residues, 12234.317 Da.
entity_FMN, non-polymer, 456.344 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAUACACAAGAGUGAUUGA
AACUAAGUCUGUGUAUCC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 165 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
Entities:
Entity 1, unit_1 38 residues - 12234.317 Da.
| 1 | G | G | A | U | A | C | A | C | A | A | ||||
| 2 | G | A | G | U | G | A | U | U | G | A | ||||
| 3 | A | A | C | U | A | A | G | U | C | U | ||||
| 4 | G | U | G | U | A | U | C | C |
Entity 2, unit_2 - C17 H21 N4 O9 P - 456.344 Da.
| 1 | FMN |