BMRB Entry 31009
Click here to enlarge.
PDB ID: 7umd
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31009
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sun, Y.; Varani, G.. "Structure of the Dengue Virus RNA Promoter" RNA 28, 1210-1223 (2022).
PubMed: 35750488
Assembly members:
entity_1, polymer, 40 residues, 12929.753 Da.
Natural source: Common Name: Dengue virus 1 Taxonomy ID: 11053 Superkingdom: Viruses Kingdom: not available Genus/species: Flavivirus Dengue virus 1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGACGUGGACCGACUUCGGU
CGGAAGGAAACUUAACGUCC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 206 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entities:
Entity 1, unit_1 40 residues - 12929.753 Da.
| 1 | G | G | A | C | G | U | G | G | A | C | |
| 2 | C | G | A | C | U | U | C | G | G | U | |
| 3 | C | G | G | A | A | G | G | A | A | A | |
| 4 | C | U | U | A | A | C | G | U | C | C |