BMRB Entry 34038
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34038
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: SINEB2 element of the long non-coding RNA activator of translation AS Uchl1 PubMed: 29453387
Deposition date: 2016-09-05 Original release date: 2017-09-15
Authors: Podbevsek, P.; Plavec, J.
Citation: Podbevsek, P.; Fasolo, F.; Bon, C.; Cimatti, L.; Reisser, S.; Carninci, P.; Bussi, G.; Zucchelli, S.; Plavec, J.; Gustincich, S.. "Structural determinants of the SINE B2 element embedded in the long non-coding RNA activator of translation AS Uchl1" Sci. Rep. 8, 3189-3189 (2018).
Assembly members:
entity_1, polymer, 29 residues, 9309.521 Da.
Natural source: Common Name: House Mouse Taxonomy ID: 10090 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Mus musculus
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CCUCGUGGUGGUUGUGAACC
ACCAUGUGG
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 63 |
15N chemical shifts | 18 |
1H chemical shifts | 93 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 29 residues - 9309.521 Da.
1 | C | C | U | C | G | U | G | G | U | G | ||||
2 | G | U | U | G | U | G | A | A | C | C | ||||
3 | A | C | C | A | U | G | U | G | G |
Samples:
sample_1: RNA (29-MER) 0.5 mM
sample_2: RNA (29-MER) 0.5 mM
sample_3: RNA (29-MER), [U-99% 13C; U-99% 15N], 0.5 mM
sample_conditions_1: pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: pH: 7; pressure: 1 atm; temperature: 273 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_2 |
2D 1H-13C HSQC | sample_3 | isotropic | sample_conditions_1 |
2D DQF-COSY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
2D HCN | sample_3 | isotropic | sample_conditions_1 |
Software:
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
SPARKY, Goddard - chemical shift assignment
VNMR, Varian - collection
NMR spectrometers:
- Agilent VNMRS 600 MHz