Click here to enlarge.
PDB ID: 5lsn
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34038
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Podbevsek, P.; Fasolo, F.; Bon, C.; Cimatti, L.; Reisser, S.; Carninci, P.; Bussi, G.; Zucchelli, S.; Plavec, J.; Gustincich, S.. "Structural determinants of the SINE B2 element embedded in the long non-coding RNA activator of translation AS Uchl1" Sci. Rep. 8, 3189-3189 (2018).
PubMed: 29453387
Assembly members:
entity_1, polymer, 29 residues, 9309.521 Da.
Natural source: Common Name: House Mouse Taxonomy ID: 10090 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Mus musculus
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CCUCGUGGUGGUUGUGAACC
ACCAUGUGG
Data type | Count |
13C chemical shifts | 63 |
15N chemical shifts | 18 |
1H chemical shifts | 93 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 29 residues - 9309.521 Da.
1 | C | C | U | C | G | U | G | G | U | G | ||||
2 | G | U | U | G | U | G | A | A | C | C | ||||
3 | A | C | C | A | U | G | U | G | G |