Click here to enlarge.
PDB ID: 5mta
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34083
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Juribasic Kulcsar, M.; Gabelica, V.; Plavec, J.. "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes" .
Assembly members:
entity_1, polymer, 34 residues, 10664.855 Da.
Natural source: Common Name: malaria parasite P. falciparum Taxonomy ID: 5833 Superkingdom: Eukaryota Kingdom: not available Genus/species: Plasmodium falciparum
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CAGGGTTAAGGGTATAACTT
TAGGGGTTAGGGTT
Data type | Count |
1H chemical shifts | 301 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 34 residues - 10664.855 Da.
1 | DC | DA | DG | DG | DG | DT | DT | DA | DA | DG | ||||
2 | DG | DG | DT | DA | DT | DA | DA | DC | DT | DT | ||||
3 | DT | DA | DG | DG | DG | DG | DT | DT | DA | DG | ||||
4 | DG | DG | DT | DT |