BMRB Entry 34086
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34086
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand PubMed: 28524432
Deposition date: 2017-01-16 Original release date: 2017-05-25
Authors: Wirmer-Bartoschek, J.; Jonker, H.; Bendel, L.; Gruen, T.; Bazzicalupi, C.; Messori, L.; Gratteri, P.; Schwalbe, H.
Citation: Wirmer-Bartoschek, J.; Bendel, L.; Jonker, H.; Grun, J.; Papi, F.; Bazzicalupi, C.; Messori, L.; Gratteri, P.; Schwalbe, H.. "Solution NMR Structure of a Ligand/Hybrid-2-G-Quadruplex Complex Reveals Rearrangements that Affect Ligand Binding." Angew. Chem. Int. Ed. Engl. 56, 7102-7106 (2017).
Assembly members:
entity_1, polymer, 26 residues, 8200.269 Da.
entity_K, non-polymer, 39.098 Da.
entity_AUZ, non-polymer, 794.406 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTAGGGTTAGGGTTAGGGTT
AGGGTT
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 274 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
2 | entity_2, 1 | 2 |
3 | entity_2, 2 | 2 |
4 | entity_3 | 3 |
Entities:
Entity 1, entity_1 26 residues - 8200.269 Da.
1 | DT | DT | DA | DG | DG | DG | DT | DT | DA | DG | ||||
2 | DG | DG | DT | DT | DA | DG | DG | DG | DT | DT | ||||
3 | DA | DG | DG | DG | DT | DT |
Entity 2, entity_2, 1 - K - 39.098 Da.
1 | K |
Entity 3, entity_3 - C24 H24 Au2 N4 O2 - 794.406 Da.
1 | AUZ |
Samples:
sample_1: Auoxo6 1.3 mM; DNA 26mer 1 mM; DSS 0.3 mM; KPi 25 mM; potassium chloride 70 mM
sample_2: Auoxo6 1.3 mM; DNA 26mer 1 mM; DSS 0.3 mM; KPi 25 mM; potassium chloride 70 mM
sample_conditions_1: ionic strength: 95 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 95 mM; pH: 7; pressure: 1 atm; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | sample_1 | isotropic | sample_conditions_1 |
2D NOESY | sample_2 | isotropic | sample_conditions_2 |
2D COSY | sample_1 | isotropic | sample_conditions_1 |
2D COSY | sample_2 | isotropic | sample_conditions_2 |
2D 1H-13C HSQC aliphatic | sample_2 | isotropic | sample_conditions_2 |
2D 1H-13C HSQC aromatic | sample_2 | isotropic | sample_conditions_2 |
Software:
ARIA v1.2 HJ development version, Linge, O'Donoghue and Nilges - refinement, structure calculation
CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - structure calculation
SPARKY v3.114, Goddard and Kneller - chemical shift assignment, data analysis, peak picking
TOPSPIN v3.2, Bruker Biospin - collection, processing
NMR spectrometers:
- Bruker AVIII 600 MHz
- Bruker AV700 700 MHz