BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34136

Title: M2 G-quadruplex 20 wt% ethylene glycol   PubMed: 29648656

Deposition date: 2017-05-11 Original release date: 2018-04-06

Authors: Trajkovski, M.; Plavec, J.; Endoh, T.; Tateishi-Karimata, H.; Sugimoto, N.

Citation: Trajkovski, Marko; Endoh, Tamaki; Tateishi-Karimata, Hisae; Ohyama, Tatsuya; Tanaka, Shigenori; Plavec, Janez; Sugimoto, Naoki. "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations"  Nucleic Acids Res. 46, 4301-4315 (2018).

Assembly members:
entity_1, polymer, 20 residues, 6321.064 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: TAGGGACGGGCGGGCAGGGT

Data sets:
Data typeCount
1H chemical shifts184

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 20 residues - 6321.064 Da.

1   DTDADGDGDGDADCDGDGDG
2   DCDGDGDGDCDADGDGDGDT

Samples:

sample_1: M2 20EG 0.2 mM; potassium chloride 100 mM; potassium phosphate 20 mM

sample_conditions_1: ionic strength: 120 mM; pH: 7.0; pressure: 1 bar; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1anisotropicsample_conditions_1
2D 1H-1H TOCSYsample_1anisotropicsample_conditions_1
2D DQF-COSYsample_1anisotropicsample_conditions_1

Software:

AMBER v14, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation

VNMR, Varian - collection

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Agilent-Varian Agilent-Varian 'Uniform NMR System' 1 600 MHz
  • Agilent-Varian Agilent-Varian 'Uniform NMR System' 2 800 MHz