Click here to enlarge.
PDB ID: 5o4d
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34145
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Marusic, Maja; Plavec, Janez. "Towards Understanding of Polymorphism of the G-rich Region of Human Papillomavirus Type 52" Molecules 24, E1294-E1294 (2019).
PubMed: 30987050
Assembly members:
entity_1, polymer, 23 residues, 7276.684 Da.
Natural source: Common Name: Human papillomavirus type 52 Taxonomy ID: 10618 Superkingdom: Viruses Kingdom: not available Genus/species: Alphapapillomavirus Alphapapillomavirus 9
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGTAGGGCAGGGGACACAG
GGT
Data type | Count |
13C chemical shifts | 27 |
1H chemical shifts | 221 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 23 residues - 7276.684 Da.
1 | DG | DG | DG | DT | DA | DG | DG | DG | DC | DA | ||||
2 | DG | DG | DG | DG | DA | DC | DA | DC | DA | DG | ||||
3 | DG | DG | DT |