Click here to enlarge.
PDB ID: 6gzn
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34297
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Lenarcic Zivkovic, M.; Rozman, J.; Plavec, J.. "Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex." Angew. Chem. Int. Ed. Engl. 57, 15395-15399 (2018).
PubMed: 30222243
Assembly members:
entity_1, polymer, 20 residues, 6410.127 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGTAGGGAGCGGGAGAGGG
Data type | Count |
1H chemical shifts | 156 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 20 residues - 6410.127 Da.
1 | DG | DG | DG | DT | DA | DG | DG | DG | DA | DG | |
2 | DC | DG | DG | DG | DA | DG | DA | DG | DG | DG |