BMRB Entry 34297
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34297
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex PubMed: 30222243
Deposition date: 2018-07-04 Original release date: 2018-09-21
Authors: Lenarcic Zivkovic, M.; Rozman, J.; Plavec, J.
Citation: Lenarcic Zivkovic, M.; Rozman, J.; Plavec, J.. "Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex." Angew. Chem. Int. Ed. Engl. 57, 15395-15399 (2018).
Assembly members:
entity_1, polymer, 20 residues, 6410.127 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGTAGGGAGCGGGAGAGGG
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 156 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 20 residues - 6410.127 Da.
1 | DG | DG | DG | DT | DA | DG | DG | DG | DA | DG | |
2 | DC | DG | DG | DG | DA | DG | DA | DG | DG | DG |
Samples:
sample_1: DNA (5'-D(*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*AP*GP*GP*G)-3') 0.6 mM
sample_2: DNA (5'-D(*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*AP*GP*GP*G)-3') 0.8 mM
sample_conditions_1: ionic strength: 100 mM; pH: 7.0; pressure: 1 atm; temperature: 278 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
2D DQF-COSY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC aliphatic | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
Software:
SPARKY, Goddard - chemical shift assignment
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
NMR spectrometers:
- Agilent DD2 600 MHz
- Varian INOVA 800 MHz