BMRB Entry 34524
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34524
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of a parallel c-Myc modified with 3' duplex stem-loop overhang PubMed: 32975874
Deposition date: 2020-06-30 Original release date: 2020-10-01
Authors: Vianney, Y.; Weisz, K.
Citation: Vianney, Y.; Preckwinkel, P.; Mohr, S.; Weisz, K.. "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands" Chemistry 26, 16910-16922 (2020).
Assembly members:
entity_1, polymer, 36 residues, 11315.241 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGAGGGTGGGTAGGGTGGGC
TAGTCATTTTGACTAG
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 34 |
1H chemical shifts | 251 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entities:
Entity 1, unit_1 36 residues - 11315.241 Da.
1 | DT | DG | DA | DG | DG | DG | DT | DG | DG | DG | ||||
2 | DT | DA | DG | DG | DG | DT | DG | DG | DG | DC | ||||
3 | DT | DA | DG | DT | DC | DA | DT | DT | DT | DT | ||||
4 | DG | DA | DC | DT | DA | DG |
Samples:
sample_1: Nucleic acid 0.5 mM; potassium phosphate buffer 10 mM
sample_2: Nucleic acid 0.5 mM; potassium phosphate buffer 10 mM
sample_conditions_1: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 293 K
sample_conditions_2: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 293 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
2D DQF-COSY | sample_2 | isotropic | sample_conditions_2 |
Software:
CcpNmr Analysis v2.4.2, G.W. Vuister, R.H. Fogh - chemical shift assignment, data analysis, peak picking
X-PLOR NIH v2.52, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
Amber v16, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
NMR spectrometers:
- Bruker AVANCE NEO 600 MHz