Click here to enlarge.
PDB ID: 6zte
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34533
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vianney, Y.; Preckwinkel, P.; Mohr, S.; Weisz, K.. "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands" Chemistry 26, 16910-16922 (2020).
PubMed: 32975874
Assembly members:
entity_1, polymer, 36 residues, 11340.253 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GATCAGTTTTACTGATCGGG
TGGTGGGTGGGGAAGG
Data type | Count |
1H chemical shifts | 242 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 36 residues - 11340.253 Da.
1 | DG | DA | DT | DC | DA | DG | DT | DT | DT | DT | ||||
2 | DA | DC | DT | DG | DA | DT | DC | DG | DG | DG | ||||
3 | DT | DG | DG | DT | DG | DG | DG | DT | DG | DG | ||||
4 | DG | DG | DA | DA | DG | DG |