Click here to enlarge.
PDB ID: 6zx7
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34543
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Bielskute, S.; Plavec, J.; Podbevsek, P.. "Oxidative lesions modulate G-quadruplex stability and structure in the human BCL2 promoter" Nucleic Acids Res. 49, 2346-2356 (2021).
PubMed: 33638996
Assembly members:
entity_1, polymer, 25 residues, 7961.097 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CGGGCGCGGGAGGAAGGGGG
CGGGA
Data type | Count |
13C chemical shifts | 26 |
1H chemical shifts | 140 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 25 residues - 7961.097 Da.
1 | DC | DG | DG | DG | DC | DG | DC | DG | DG | DG | ||||
2 | DA | DG | DG | DA | DA | DG | DG | DG | DG | DG | ||||
3 | DC | DG | DG | DG | DA |