BMRB Entry 34714
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34714
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex PubMed: 35993443
Deposition date: 2022-03-21 Original release date: 2022-08-26
Authors: Ghosh, A.; Trajkovski, M.; Teulade-Fichou, M.; Gabelica, V.; Plavec, J.
Citation: Ghosh, A.; Trajkovski, M.; Teulade-Fichou, M.; Gabelica, V.; Plavec, J.. "Phen-DC3 Induces Refolding of Human Telomeric DNA into a Chair-Type Antiparallel G-Quadruplex through Ligand Intercalation" Angew. Chem. Int. Ed. Engl. 61, e202207384-e202207384 (2022).
Assembly members:
entity_1, polymer, 23 residues, 7287.690 Da.
entity_PQ3, non-polymer, 550.609 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TAGGGTTAGGGTTAGGGTTA
GGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 231 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
Entities:
Entity 1, unit_1 23 residues - 7287.690 Da.
| 1 | DT | DA | DG | DG | DG | DT | DT | DA | DG | DG | ||||
| 2 | DG | DT | DT | DA | DG | DG | DG | DT | DT | DA | ||||
| 3 | DG | DG | DG |
Entity 2, unit_2 - C34 H26 N6 O2 - 550.609 Da.
| 1 | PQ3 |
Samples:
sample_1: 23TAG, 13C at guanine, 200 uM; KCl 70 mM; potassium phosphate 20 mM
sample_2: 23TAG, 15N at guanine, 200 uM; KCl 70 mM; potassium phosphate 20 mM
sample_3: 23TAG 500 uM; KCl 70 mM; potassium phosphate 20 mM
sample_conditions_1: ionic strength: 70 mM; pH: 7; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H TOCSY | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
Software:
Amber v20, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation
NMRFAM-SPARKY v1.414, Lee, Woonghee, Marco Tonelli, and John L. Markley - chemical shift assignment
TopSpin v4.1.3, Bruker Biospin - collection, processing
NMR spectrometers:
- Bruker AVANCE NEO 700 MHz
- Bruker AVANCE III 800 MHz
- Bruker AVANCE NEO 600 MHz