Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34741
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vianney, Y.; Weisz, K.. "High-affinity binding at quadruplex-duplex junctions: rather the rule than the exception" Nucleic Acids Res. 50, 11948-11964 (2022).
PubMed: 36416262
Assembly members:
entity_1, polymer, 27 residues, 8445.403 Da.
entity_LNF, non-polymer, 493.662 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGTTGGCGCGAAGCATTCGC
GGGTTGG
Data type | Count |
13C chemical shifts | 30 |
1H chemical shifts | 220 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
2 | unit_2 | 2 |
Entity 1, unit_1 27 residues - 8445.403 Da.
1 | DG | DG | DT | DT | DG | DG | DC | DG | DC | DG | ||||
2 | DA | DA | DG | DC | DA | DT | DT | DC | DG | DC | ||||
3 | DG | DG | DG | DT | DT | DG | DG |
Entity 2, unit_2 - C32 H37 N4 O 1 - 493.662 Da.
1 | LNF |
sample_1: PIQ-QD2l 0.64 mM
sample_conditions_1: ionic strength: 120 mM; pH: 7.0; pressure: 1 atm; temperature: 303 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
Amber v18, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
X-PLOR NIH v3.0.3, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
CcpNmr Analysis v2.4.2, CCPN - chemical shift assignment
TopSpin v4.0.7, Bruker Biospin - processing