Click here to enlarge.
PDB ID: 8bm6
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34769
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Novotny, A.; Plavec, J.; Kocman, V.. "Structural polymorphism driven by a register shift in a CGAG-rich region found in the promoter of the neurodevelopmental regulator AUTS2 gene" Nucleic Acids Res. 51, 2602-2613 (2023).
PubMed: 36864756
Assembly members:
entity_1, polymer, 36 residues, 11254.246 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CGAGCGAGCGAGCGAAAGCA
CGAACGAGCGAGCGAG
Data type | Count |
1H chemical shifts | 233 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 36 residues - 11254.246 Da.
1 | DC | DG | DA | DG | DC | DG | DA | DG | DC | DG | ||||
2 | DA | DG | DC | DG | DA | DA | DA | DG | DC | DA | ||||
3 | DC | DG | DA | DA | DC | DG | DA | DG | DC | DG | ||||
4 | DA | DG | DC | DG | DA | DG |