BMRB Entry 34780
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34780
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Tetra-stranded double-ion dependent DNA (diDNA) NMR structure of telomeric C.elegans fragment
Deposition date: 2022-12-15 Original release date: 2024-03-07
Authors: Lenarcic Zivkovic, M.; Trantirek, L.
Citation: Lenarcic Zivkovic, M.; Trantirek, L.. "Tetra-stranded double-ion dependent DNA (diDNA) NMR structure of telomeric C.elegans fragment" .
Assembly members:
entity_1, polymer, 21 residues, 6510.193 Da.
Natural source: Common Name: C. elegans Taxonomy ID: 6239 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Caenorhabditis elegans
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCTTAGGCTTAGGCTTAGG
C
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 207 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entities:
Entity 1, unit_1 21 residues - 6510.193 Da.
1 | DG | DG | DC | DT | DT | DA | DG | DG | DC | DT | ||||
2 | DT | DA | DG | DG | DC | DT | DT | DA | DG | DG | ||||
3 | DC |
Samples:
sample_1: DNA (5'-D(*GP*GP*CP*TP*TP*AP*GP*GP*CP*TP*TP*AP*GP*GP*CP*TP*TP*AP*GP*GP*C)-3') 0.5 mM
sample_2: DNA (5'-D(*GP*GP*CP*TP*TP*AP*GP*GP*CP*TP*TP*AP*GP*GP*CP*TP*TP*AP*GP*GP*C)-3') 0.5 mM
sample_conditions_1: ionic strength: 145 mM; pH: 7.5; pressure: 1 atm; temperature: 298 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC aromatic | sample_2 | isotropic | sample_conditions_1 |
Software:
NMRFAM-SPARKY, Lee, Tonelli, Markley - chemical shift assignment
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
NMR spectrometers:
- Bruker AVANCE NEO 950 MHz
- Bruker AVANCE NEO 850 MHz