Click here to enlarge.
PDB ID: 8bzu
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34780
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Lenarcic Zivkovic, M.; Trantirek, L.. "Tetra-stranded double-ion dependent DNA (diDNA) NMR structure of telomeric C.elegans fragment" .
Assembly members:
entity_1, polymer, 21 residues, 6510.193 Da.
Natural source: Common Name: C. elegans Taxonomy ID: 6239 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Caenorhabditis elegans
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCTTAGGCTTAGGCTTAGG
C
Data type | Count |
1H chemical shifts | 207 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 21 residues - 6510.193 Da.
1 | DG | DG | DC | DT | DT | DA | DG | DG | DC | DT | ||||
2 | DT | DA | DG | DG | DC | DT | DT | DA | DG | DG | ||||
3 | DC |