Click here to enlarge.
PDB ID: 8q4o
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34843
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Orehova, Maria; Plavec, Janez; Kocman, VojC. "High-Resolution Structure of RNA G-Quadruplex Containing Unique Structural Motifs Originating from the 5'-UTR of Human Tyrosine Kinase 2 (TYK2)" ACS Omega 9, 7215-7229 (2024).
PubMed: 38371751
Assembly members:
entity_1, polymer, 23 residues, 7507.481 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CGGUAGCGGGUAUGGGUCCG
GGU
Data type | Count |
1H chemical shifts | 113 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 23 residues - 7507.481 Da.
1 | C | G | G | U | A | G | C | G | G | G | ||||
2 | U | A | U | G | G | G | U | C | C | G | ||||
3 | G | G | U |